Mature sequence dre-miR-141-5p

Accession numberMIMAT0031974
IDdre-miR-141-5p
Stem-Loop dre-mir-141
Sequence
caucuuaccugacagugcuugg
Get sequence
Deep sequencing291 reads, 10 experiments
Database links
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).