Mature sequence dre-miR-34c-3p

Accession numberMIMAT0032011
IDdre-miR-34c-3p
Stem-Loop dre-mir-34c
Sequence
aaucacuaaccucacuaccagg
Get sequence
Deep sequencing47 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).