Mature sequence gma-miR5042-3p

Accession numberMIMAT0032123
IDgma-miR5042-3p
Stem-Loop gma-MIR5042
Sequence
uggggcuugauccaagauagg
Get sequence
Deep sequencing reads, experiments

References

1
2