Mature sequence sma-miR-31-3p

Accession numberMIMAT0032136
IDsma-miR-31-3p
Stem-Loop sma-mir-31
Sequence
agcuuccccugauacugccaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).