Mature sequence ssa-miR-200b-5p

Accession numberMIMAT0032479
IDssa-miR-200b-5p
Stem-Loop ssa-mir-200b-1 ssa-mir-200b-2
Sequence
caucuuaccugacagugcugga
Get sequence
Deep sequencing reads, experiments

References

1