Mature sequence sma-miR-36b-3p

Accession numberMIMAT0033515
IDsma-miR-36b-3p
Stem-Loop sma-mir-36b
Sequence
ccaccggguagacauucauccgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).