Mature sequence gra-miR7502b

Accession numberMIMAT0034013
IDgra-miR7502b
Stem-Loop gra-MIR7502b
Sequence
uuguuaaaaguuucauccauu
Get sequence
Deep sequencing reads, experiments

References

1