Mature sequence gra-miR8762a

Accession numberMIMAT0034192
IDgra-miR8762a
Stem-Loop gra-MIR8762a
Sequence
uuaacauuuguuaacuuugcugac
Get sequence
Deep sequencing reads, experiments

References

1