Mature sequence sly-miR169e-5p

Accession numberMIMAT0035475
IDsly-miR169e-5p
Stem-Loop sly-MIR169e
Sequence
uagccaaggaugacuugccuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).