Mature sequence tae-miR9656-3p

Accession numberMIMAT0035763
IDtae-miR9656-3p
Stem-Loop tae-MIR9656
Sequence
cuucgagacucugaacagcgg
Get sequence
Deep sequencing747251 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).