Mature sequence tae-miR1127b-3p

Accession numberMIMAT0035769
IDtae-miR1127b-3p
Stem-Loop tae-MIR1127b
Sequence
acaaguauuucuggacggagg
Get sequence
Deep sequencing183489 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).