Mature sequence tae-miR9661-5p

Accession numberMIMAT0035770
IDtae-miR9661-5p
Stem-Loop tae-MIR9661
Sequence
ugaaguagagcagggaccuca
Get sequence
Deep sequencing20 reads, 18 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).