Mature sequence tae-miR9665-3p

Accession numberMIMAT0035776
IDtae-miR9665-3p
Stem-Loop tae-MIR9665
Sequence
gcuagcaguguaaacucaaauca
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).