Mature sequence tae-miR9667-5p

Accession numberMIMAT0035779
IDtae-miR9667-5p
Stem-Loop tae-MIR9667
Sequence
aaauauggcaaacaaugaaug
Get sequence
Deep sequencing5 reads, 4 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).