Mature sequence tae-miR1120c-5p

Accession numberMIMAT0035799
IDtae-miR1120c-5p
Stem-Loop tae-MIR1120c
Sequence
uaauauaagaacguuuuugac
Get sequence
Deep sequencing44967 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).