Mature sequence tae-miR9657b-3p

Accession numberMIMAT0035811
IDtae-miR9657b-3p
Stem-Loop tae-MIR9657b
Sequence
cgugcuuccucgucgaacggu
Get sequence
Deep sequencing31018 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).