Mature sequence chi-miR-135a

Accession numberMIMAT0035952
IDchi-miR-135a
Stem-Loop chi-mir-135a
Sequence
uauggcuuuuuauuccuauguga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).