Mature sequence chi-miR-181d

Accession numberMIMAT0036005
IDchi-miR-181d
Stem-Loop chi-mir-181d
Sequence
aacauucauuguugucggugggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).