Mature sequence chi-miR-2284b

Accession numberMIMAT0036078
IDchi-miR-2284b
Stem-Loop chi-mir-2284b
Sequence
ugaaaaguuuguucggguua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).