Mature sequence chi-miR-2284c

Accession numberMIMAT0036079
IDchi-miR-2284c
Stem-Loop chi-mir-2284c
Sequence
aaaaucuaagugaacuuuuugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).