Mature sequence chi-miR-2284e

Accession numberMIMAT0036096
IDchi-miR-2284e
Stem-Loop chi-mir-2284e
Sequence
aaaacuugaaugaacucuuugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).