Mature sequence chi-miR-376a

Accession numberMIMAT0036184
IDchi-miR-376a
Stem-Loop chi-mir-376a
Sequence
guagauucuccuucuaugagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).