Mature sequence chi-miR-429

Accession numberMIMAT0036226
IDchi-miR-429
Stem-Loop chi-mir-429
Sequence
uaauacugucugguaaugccg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).