Mature sequence chi-miR-494

Accession numberMIMAT0036255
IDchi-miR-494
Stem-Loop chi-mir-494
Sequence
ugaaacauacacgggaaaccucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).