Mature sequence tch-miR-200a-3p

Accession numberMIMAT0036466
IDtch-miR-200a-3p
Stem-Loop tch-mir-200a
Sequence
uaacacugucugguaacgauguu
Get sequence
Deep sequencing reads, experiments

References

1