Mature sequence tch-miR-141-3p

Accession numberMIMAT0036489
IDtch-miR-141-3p
Stem-Loop tch-mir-141
Sequence
uaacacugucugguaaagauggc
Get sequence
Deep sequencing reads, experiments

References

1