Mature sequence tae-miR9778

Accession numberMIMAT0036991
IDtae-miR9778
Stem-Loop tae-MIR9778
Sequence
ugcaucaucucgaacucgucg
Get sequence
Deep sequencing505 reads, 113 experiments

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).