Mature sequence ame-miR-9886-3p

Accession numberMIMAT0037290
IDame-miR-9886-3p
Stem-Loop ame-mir-9886
Sequence
uaggcgucacguuguggaacg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).