Mature sequence gma-miR4348a-3p

Accession numberMIMAT0037389
IDgma-miR4348a-3p
Stem-Loop gma-MIR4348a
Sequence
uaucacaaugucaucaucuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
3