Mature sequence bta-miR-2285ag-3p

Accession numberMIMAT0040923
IDbta-miR-2285ag-3p
Stem-Loop bta-mir-2285ag
Sequence
uccaagugaacuuuuuggcuaa
Get sequence
Deep sequencing109 reads, 43 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).