Mature sequence bta-miR-668-3p

Accession numberMIMAT0040936
IDbta-miR-668-3p
Stem-Loop bta-mir-668
Sequence
augucacucggcccacuaccc
Get sequence
Deep sequencing97 reads, 42 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).