Mature sequence fhe-miR-2b

Accession numberMIMAT0045206
IDfhe-miR-2b
Stem-Loop fhe-mir-2b
Sequence
guaucacagcccugcuugggaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).