Mature sequence bta-miR-2285aq

Accession numberMIMAT0046365
IDbta-miR-2285aq
Stem-Loop bta-mir-2285aq-1 bta-mir-2285aq-2
Sequence
aagcccagaugaacuuuuug
Get sequence
Deep sequencing152 reads, 8 experiments

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).