Mature sequence bta-miR-2285be

Accession numberMIMAT0046380
IDbta-miR-2285be
Stem-Loop bta-mir-2285be
Sequence
aaaacucgagcaaacuuuuugg
Get sequence
Deep sequencing36 reads, 21 experiments

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).