Mature sequence bta-miR-2285bo

Accession numberMIMAT0046627
IDbta-miR-2285bo
Stem-Loop bta-mir-2285bo
Sequence
ugaaaaguucguucgaguuuu
Get sequence
Deep sequencing159269 reads, 77 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).