Mature sequence bta-miR-2285by

Accession numberMIMAT0046645
IDbta-miR-2285by
Stem-Loop bta-mir-2285by
Sequence
aaaaguuugguuggguuuuucu
Get sequence
Deep sequencing74 reads, 25 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).