Mature sequence bta-miR-2285bz

Accession numberMIMAT0046646
IDbta-miR-2285bz
Stem-Loop bta-mir-2285bz
Sequence
aauaaguucguuuggguuuuu
Get sequence
Deep sequencing6540 reads, 62 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).