Mature sequence bta-miR-2285cg

Accession numberMIMAT0046665
IDbta-miR-2285cg
Stem-Loop bta-mir-2285cg
Sequence
aaaaccagaaugaaacuuuuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).