Mature sequence bta-miR-2285cx

• Accession number: MIMAT0046704
• ID: bta-miR-2285cx
• Stem-Loop: bta-mir-2285cx
• Sequence: aacacccaaaugaacuuuuuga
• Deep sequencing: 49 reads, 18 experiments

References

1. PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).