Mature sequence bta-miR-2285cy

Accession numberMIMAT0046705
IDbta-miR-2285cy
Stem-Loop bta-mir-2285cy
Sequence
aaaaccagaaugaacuuuuuug
Get sequence
Deep sequencing5350 reads, 77 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).