Mature sequence bta-miR-2285dc

Accession numberMIMAT0046710
IDbta-miR-2285dc
Stem-Loop bta-mir-2285dc
Sequence
aaaaaguuaguuuagguuuuuc
Get sequence
Deep sequencing88 reads, 41 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).