Mature sequence bta-miR-2285dg

Accession numberMIMAT0046736
IDbta-miR-2285dg
Stem-Loop bta-mir-2285dg
Sequence
aaaaaccgaaaugaacuuuugg
Get sequence
Deep sequencing383 reads, 66 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).