Mature sequence bta-miR-2285dk

Accession numberMIMAT0046749
IDbta-miR-2285dk
Stem-Loop bta-mir-2285dk
Sequence
ccugaaugaacauuuuggccaacu
Get sequence
Deep sequencing4953 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).