miRBase entry: hsa-mir-28

Stem-loop hsa-mir-28


Accession
MI0000086
Symbol
HGNC: MIR28
Description
Homo sapiens hsa-mir-28 precursor miRNA
Gene family
MIPF0000057; mir-28

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR28 is a type of microRNA that has been shown to repress the expression of ΔVSP-175-myc, IGF1, and MDSC percentage in various experiments [PMC3937270] [PMC7782091]. In one study, the combination of MIR28 and miR83 was found to decrease ΔVSP-175-myc expression to 48%, while the combination of miR86, MIR28, and miR83 decreased expression to 33%, and the combination of miR88, miR86, MIR28, and miR83 decreased expression to 19% [PMC3937270]. In another study using a co-culture system, knockdown of miR21 and miR130b along with overexpression of MIR28 resulted in a significant decrease in IGF1 expression (P = 0.005) and MDSC percentage (P = 0.005) [PMC7782091]. These findings suggest that MIR28 plays a role in regulating the expression of various genes involved in different biological processes.

Literature search
90 open access papers mention hsa-mir-28
(309 sentences)

Sequence

150537 reads, 1128 reads per million, 158 experiments
gguccuugcccucAAGGAGCUCACAGUCUAUUGAGuuaccuuucugacuuuccCACUAGAUUGUGAGCUCCUGGAgggcaggcacu
(((.(((((((((.((((((((((((((((.(((((((......)))))....)).)))))))))))))))).))))))))).)))

Structure
   c         A                U  ----     cc 
ggu cuugcccuc AGGAGCUCACAGUCUA UG    AGuua  u
||| ||||||||| |||||||||||||||| ||    |||||   
uca ggacgggAG UCCUCGAGUGUUAGAU AC    ucagu  u
   c         G                C  ccuu     cu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr3: 188688781-188688866 [+]

Disease association
hsa-mir-28 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-28-5p

Accession MIMAT0000085
Description Homo sapiens hsa-miR-28-5p mature miRNA
Sequence 14 - AAGGAGCUCACAGUCUAUUGAG - 35
Evidence experimental
cloned [1-3], Northern [1]
Database links
Predicted targets

Mature hsa-miR-28-3p

Accession MIMAT0004502
Description Homo sapiens hsa-miR-28-3p mature miRNA
Sequence 54 - CACUAGAUUGUGAGCUCCUGGA - 75
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52