MIR32 is a microRNA that has been found to be upregulated in thyroid cancer compared to benign thyroid tumors in a microarray study [PMC4315163]. However, the functional implications of MIR32 in papillary thyroid carcinoma (PTC) are still unknown [PMC4315163]. Studies have shown that MIR32 can directly inhibit the RNA virus primate foamy retrovirus type 1, which is comparable to HIV1, at the protein level [PMC7833564]. Additionally, MIR32 has been found to have a supplementary degradative function in the coding region for influenza PB1 [PMC7833564]. In the context of Tmprss2 as a critical drug target, it has been suggested that MIR32 could be employed as a potential therapeutic for specific suppression of Tmprss2 [PMC7833564]. Differential gene analysis identified MIR32 as one of the top 40 differential genes in thyroid cancer [PMC9730279]. In experimental studies, MIR32 mimics and antagomirs were transfected into 293 T cells to investigate their effects on PIKfyve-3' UTR Wt and PIKfyve-3' UTR Mut expression levels [PMC6967090]. Real-time PCR assays were used to assess the expression levels of various miRNAs including MIR32 in different experimental conditions [PMC3424561] and it was found that miRNAs such as miR140, miR141, and miR184 showed decreased abundance while miRNAs such as miR150 and miR146 showed increased abundance in knockout mice compared to wild-type mice [PMC10001410].
U - uu c ggagaUAUUGCACAU ACUAAGUUGCAu g gu a ||||||||||||||| |||||||||||| | || cuUUUAUAGUGUGUG UGAUUUAACgua c cg c - a uc g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000090 |
Description | Homo sapiens hsa-miR-32-5p mature miRNA |
Sequence | 6 - UAUUGCACAUUACUAAGUUGCA - 27 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004505 |
Description | Homo sapiens hsa-miR-32-3p mature miRNA |
Sequence | 47 - CAAUUUAGUGUGUGUGAUAUUU - 68 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|