Stem-loop sequence dme-mir-2b-1

Accession

MI0000119 (change log)

Description

Drosophila melanogaster miR-2b-1 stem-loop

Gene family

MIPF0000049; mir-2

Literature search

28 open access papers mention dme-mir-2b-1
(114 sentences)

Stem-loop

     u    ug         -    a    ----c      u 
5' cu caac  ucuucaaag uggc guga     auguug c
   || ||||  ||||||||| |||| ||||     ||||||  
3' gg guug  aggaguuuc accg cacu     uauaac a
     c    cg         g    a    auacu      a 

Deep sequencing

1099244 reads, 1.95e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Stark et al. [2] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 8258616-8258692 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000056F952_7227
• Rfam:mir-2
• miRBase Tracker:MI0000119

Mature sequence dme-miR-2b-1-5p

• Accession: MIMAT0020782
• Sequence: 9 - gucuucaaaguggcagugacaug - 31
• Deep sequencing: 1863 reads, 46 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00004BBAAE_7227

Mature sequence dme-miR-2b-3p

• Accession: MIMAT0000107
• Previous IDs: dme-miR-2b
• Sequence: 48 - uaucacagccagcuuugaggagc - 70
• Deep sequencing: 2265994 reads, 49 experiments
• Evidence: experimental; cloned [1,4], Northern [1,3], 454 [5-6], Illumina [6]
• Database links:
  • RNAcentral:URS00005254FD_7227
• Predicted targets:
  • TargetScanFly:dme-miR-2b
  • microrna.org:dme-miR-2b-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
3. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
4. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).