Stem-loop sequence mmu-mir-124-3

Accession

MI0000150 (change log)

Previous IDs

mmu-mir-124a;mmu-mir-124a-3

Symbol

MGI:Mir124a-3

Description

Mus musculus miR-124-3 stem-loop

Gene family

MIPF0000021; mir-124

Literature search

225 open access papers mention mmu-mir-124-3
(2529 sentences)

Stem-loop

       - c        a   ga        uaaug 
5' cucu g guguucac gcg  ccuugauu     u
   |||| | |||||||| |||  ||||||||      
3' gaga c cguaagug cgc  ggaauuaa     c
       a -        g   ac        cauau 

Deep sequencing

1179317 reads, 7.02e+03 reads per million, 79 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MI0000716) on chromosome 14, mir-124-2 (MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124a here, MI0000150) on chromosome 2. All have closely related predicted human homologues (MI0000443, MI0000444 and MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr2: 180894040-180894107 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000114313 ; RP23-359C15.10-001; exon 1

  ENSMUST00000083520 ; Mir124a-3-201; exon 1

  ENSMUST00000183124 ; Gm27032-001; exon 1

Database links

• EntrezGene:Mir124a-3
• MGI:Mir124a-3
• RNAcentral:URS000075A274_10090
• miRBase Tracker:MI0000150

Mature sequence mmu-miR-124-5p

• Accession: MIMAT0004527
• Previous IDs: mmu-miR-124*
• Sequence: 6 - cguguucacagcggaccuugau - 27
• Deep sequencing: 8477 reads, 35 experiments
• Evidence: experimental; cloned [4], Illumina [5-6]
• Database links:
  • RNAcentral:URS00003AA409_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-124-5p
  • miRDB:mmu-miR-124-5p
  • microrna.org:mmu-miR-124-5p

Mature sequence mmu-miR-124-3p

• Accession: MIMAT0000134
• Previous IDs: mmu-miR-124a;mmu-miR-124
• Sequence: 44 - uaaggcacgcggugaaugcc - 63
• Deep sequencing: 3529575 reads, 78 experiments
• Evidence: experimental; cloned [1-4], Illumina [5-6]
• Database links:
  • RNAcentral:URS000020BE6A_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-124-3p.1
  • miRDB:mmu-miR-124-3p
  • microrna.org:mmu-miR-124-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).