![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-146a |
|||||
Accession | MI0000170 (change log) | ||||
Previous IDs | mmu-mir-146 | ||||
Symbol | MGI:Mir146 | ||||
Description | Mus musculus miR-146a stem-loop | ||||
Gene family | MIPF0000103; mir-146 | ||||
Literature search |
![]()
364 open access papers mention mmu-mir-146a | ||||
Stem-loop |
cu c auauc 5' agcu gagaacugaauu cauggguu a |||| |||||||||||| |||||||| 3' ucga uucuugacuuaa guguccag a -c a acugu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-146a-5p |
|
Accession | MIMAT0000158 |
Previous IDs | mmu-miR-146;mmu-miR-146a |
Sequence |
6 - ugagaacugaauuccauggguu - 27 |
Deep sequencing | 709100 reads, 112 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-146a-3p |
|
Accession | MIMAT0016989 |
Previous IDs | mmu-miR-146a* |
Sequence |
42 - ccugugaaauucaguucuucag - 63 |
Deep sequencing | 59 reads, 25 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|