Stem-loop sequence ath-MIR156a

AccessionMI0000178 (change log)
DescriptionArabidopsis thaliana miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

80 open access papers mention ath-MIR156a
(844 sentences)

Stem-loop 
   c      aac   -aa   a         -   -         a   ---      uu    ua 
5'  aagaga   gca   gaa cugacagaa gag agugagcac caa   aggcaa  ugca  u
    ||||||   |||   ||| ||||||||| ||| ||||||||| |||   ||||||  ||||   
3'  uucucu   cgu   cuu gacugucuu cuc ucacucgug guu   uucguu  acgu  c
   u      agu   ggc   a         u   g         c   cuc      -c    ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR156a is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 10676451-10676573 [-]
intergenic
Database links

Mature sequence ath-miR156a-5p

Accession MIMAT0000166
Previous IDsath-miR156a
Sequence

21 -  

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR156a-3p

Accession MIMAT0031865
Sequence

83 -  

gcucacugcucuuucugucaga

 - 104

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).