Stem-loop sequence ath-MIR166e

AccessionMI0000205 (change log)
DescriptionArabidopsis thaliana miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

37 open access papers mention ath-MIR166e
(292 sentences)

Stem-loop 
   u           uu      ca   g c c      uagaucuauauuugauuauauauauaugucucuu 
5'  ugaggggaaug  gucugg  cga g c uuaacu                                  c
    |||||||||||  ||||||  ||| | | ||||||                                  u
3'  acuccccuuac  cggacc  gcu c g aauugg                                  u
   a           uu      ag   g a u      cauuuuacuaguaaguacauaucugauuacuuau
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR166e, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 16775520-16775662 [-]
intergenic
Database links

Mature sequence ath-miR166e-5p

Accession MIMAT0031882
Sequence

7 -  

ggaauguugucuggcacgagg

 - 27

Get sequence
Evidence not experimental

Mature sequence ath-miR166e-3p

Accession MIMAT0000193
Previous IDsath-miR166e
Sequence

119 -  

ucggaccaggcuucauucccc

 - 139

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 3'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).